Kncnem1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kncnem1(IMPC)Bay |
| Name: |
kinocilin; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:7425780 |
| Gene: |
Kncn Location: Chr4:115741597-115745079 bp, + strand Genetic Position: Chr4, 53.06 cM
|
| Alliance: |
Kncnem1(IMPC)Bay page
|
| IMPC: |
Kncn gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CATCGGTGTCTCCGTGTCCA and CTGCAGGCAGCGGAAGTCTC that targeted exon(s) ENSMUSE00000631452.2. This resulted in deletion(s) of 54 bp (location: Chr4:115742018-115742071; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Kncn Mutation: |
5 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|