Gnb1l^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gnb1l^em1(IMPC)Tcp
• Name: guanine nucleotide binding protein (G protein), beta polypeptide 1-like; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7425719
• Gene: Gnb1l Location: Chr16:18317463-18385429 bp, + strand Genetic Position: Chr16, 11.46 cM
• Alliance: Gnb1l^em1(IMPC)Tcp page
• IMPC: Gnb1l gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGGCTTACCTAGCCGTCTTC targeting the 5' side and CACACAAGTACAATCTAGGG targeting the 3' side of a critical region (ENSMUSE00001445593 & ENSMUSE00001048285) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 1,229-bp deletion of Chr16 from 18,362,769 to 18,363,997 (GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCTT). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gnb1l Mutation: 13 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)