Ehf^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ehf^{em1(IMPC)Kmpc}
• Name: ets homologous factor; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7425649
• Gene: Ehf Location: Chr2:103093776-103133620 bp, - strand Genetic Position: Chr2, 54.43 cM
• Alliance: Ehf^{em1(IMPC)Kmpc} page
• IMPC: Ehf gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and a guide with spacer sequence GAGTCTGCAGGAGTTCACGA that targeted exon(s) ENSMUSE00000166679.2. This resulted in deletion(s) of 46 bp (location: Chr2:103109908-103109953; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ehf Mutation: 26 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)