Defb13^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Defb13^em1(IMPC)Bay
• Name: defensin beta 13; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:7425634
• Gene: Defb13 Location: Chr8:22436778-22438866 bp, + strand Genetic Position: Chr8, 10.68 cM, cytoband A4
• Alliance: Defb13^em1(IMPC)Bay page
• IMPC: Defb13 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AGGCAGCTCGTCTAAATCAT and TAGACAAAAGGTCGATCGGC that targeted exon(s) ENSMUSE00000350241.4 ENSMUSE00000391269.3 ENSMUSE00001595208.1 ENSMUSE00001595223.1 ENSMUSE00001595233.1 ENSMUSE00001595243.1 ENSMUSE00001595247.1. This resulted in deletion(s) of 7 bp (location: Chr8:22436646-22436652; GRCm39), 2278 bp (location: Chr8:22436664-22438941; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Defb13 Mutation: 8 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)