Ddx18^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx18^em1(IMPC)Bay
• Name: DEAD box helicase 18; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:7425632
• Synonyms: Ddx18^-
• Gene: Ddx18 Location: Chr1:121481564-121495709 bp, - strand Genetic Position: Chr1, 52.98 cM, cytoband E2
• Alliance: Ddx18^em1(IMPC)Bay page
• IMPC: Ddx18 gene page

Ddx18^em1(IMPC)Bay/Ddx18^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as uncompacted morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AAGCCCCGAAGGATTGTACA and ACATGATAGCTTAGGTGAAA that targeted exon(s) ENSMUSE00000158196.4. This resulted in deletion(s) of 396 bp (location: Chr1:121487784-121488179; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ddx18 Mutation: 36 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)