Cyc1^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyc1^em1(IMPC)Bay
• Name: cytochrome c-1; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:7425624
• Synonyms: Cyc1^-
• Gene: Cyc1 Location: Chr15:76227723-76230460 bp, + strand Genetic Position: Chr15, 35.74 cM
• Alliance: Cyc1^em1(IMPC)Bay page
• IMPC: Cyc1 gene page

Cyc1^em1(IMPC)Bay/Cyc1^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller, show severe developmental delay, forming an epithelium with no obvious embryonic-extraembryonic boundary and abnormal epiblast.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AGGATGGCCCTAATGATGAT and CTTATGCCGCTTCATGGCAT that targeted exon(s) ENSMUSE00000128242.4 ENSMUSE00000128243.4 ENSMUSE00000128248.4 ENSMUSE00001443126.2. This resulted in deletion(s) of 856 bp (location: Chr15:76229039-76229894; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cyc1 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)