About   Help   FAQ
Cd79aem1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Cd79aem1(IMPC)H
Name: CD79A antigen (immunoglobulin-associated alpha); endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:7425573
Gene: Cd79a  Location: Chr7:24596922-24601283 bp, + strand  Genetic Position: Chr7, 13.49 cM
Alliance: Cd79aem1(IMPC)H page
IMPC: Cd79a gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation details This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences GCAGGAACCCTAATATCACA and GGAACCCTAATATCACATGG that targeted exon(s) ENSMUSE00000199568.4. This resulted in deletion(s) of 2 bp (location: Chr7:24598631-24598632; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cd79a Mutation:  32 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory