Cbx5^em1Cya
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cbx5^em1Cya
• Name: chromobox 5; endonuclease-mediated mutation 1, Cyagen Biosciences
• MGI ID: MGI:7425366
• Gene: Cbx5 Location: Chr15:103099971-103148243 bp, - strand Genetic Position: Chr15, 58.34 cM
• Alliance: Cbx5^em1Cya page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using guide RNAs (CTCAGCGTTCAAAGCTAGTCTGG and GGCTGGATACAGTTATCACGTGG) created a deletion removing all of exons exons 3 and 4 and the coding region of exon 5. (J:326314)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cbx5 Mutation: 415 strains or lines available

References

• Original: J:326314 Zou M, et al., Heterochromatin inhibits cGAS and STING during oxidative stress-induced retinal pigment epithelium and retina degeneration. Free Radic Biol Med. 2022 Jan;178:147-160
• All: 1 reference(s)