Adora2b^em1Kois
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adora2b^em1Kois
• Name: adenosine A2b receptor; endonuclease-mediated mutation 1, Schuichi Koizumi
• MGI ID: MGI:7425327
• Gene: Adora2b Location: Chr11:62139810-62157278 bp, + strand Genetic Position: Chr11, 37.96 cM, cytoband B2
• Alliance: Adora2b^em1Kois page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using guide RNAs targeting exon 1 (GGAGCTGGTTATCGCTGCGCTGG and CCTCGCCTGCTTCGTGCTGGTGC) created a null mutation. (J:326974)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adora2b Mutation: 19 strains or lines available

References

• Original: J:326974 Tanaka M, et al., Adenosine A2B receptor down-regulates metabotropic glutamate receptor 5 in astrocytes during postnatal development. Glia. 2021 Nov;69(11):2546-2558
• All: 1 reference(s)