Del(6Rr133120)2Pike
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Del(6Rr133120)2Pike |
| Name: |
deletion, Chr 6, J Wesley Pike 2 |
| MGI ID: |
MGI:7425278 |
| Synonyms: |
FGF23-38KO |
| Gene: |
Del(6Rr133120)2Pike Location: unknown Genetic Position: Chr6, Syntenic
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
|
|
Del(6Rr133120)2Pike involves 1 genes/genome features (Rr133120)
View all
|
| |
|
Mutation details: A putative Fgf23 bone enhancer, located ~38 kb upstream, was targeted with sgRNAs (targeting TGGAAGCAAGGGATTTACAG and GAGGCTGACACAGCATGCCT) using CRISPR/Cas9 technology, resulting in a 1071 bp deletion. The deleted sequence contains putative CTCF-binding site Rr133120.
(J:281531)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Del(6Rr133120)2Pike Mutation: |
0 strains or lines available
|
|
| Original: |
J:281531 Lee SM, et al., A Control Region Near the Fibroblast Growth Factor 23 Gene Mediates Response to Phosphate, 1,25(OH)2D3, and LPS In Vivo. Endocrinology. 2019 Dec 1;160(12):2877-2891 |
| All: |
1 reference(s) |
|