About   Help   FAQ
Del(6Rr133120)2Pike
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(6Rr133120)2Pike
Name: deletion, Chr 6, J Wesley Pike 2
MGI ID: MGI:7425278
Synonyms: FGF23-38KO
Gene: Del(6Rr133120)2Pike  Location: unknown  Genetic Position: Chr6, Syntenic
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
  Del(6Rr133120)2Pike involves 1 genes/genome features (Rr133120) View all
 
Mutation detailsA putative Fgf23 bone enhancer, located ~38 kb upstream, was targeted with sgRNAs (targeting TGGAAGCAAGGGATTTACAG and GAGGCTGACACAGCATGCCT) using CRISPR/Cas9 technology, resulting in a 1071 bp deletion. The deleted sequence contains putative CTCF-binding site Rr133120. (J:281531)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(6Rr133120)2Pike Mutation:  0 strains or lines available
References
Original:  J:281531 Lee SM, et al., A Control Region Near the Fibroblast Growth Factor 23 Gene Mediates Response to Phosphate, 1,25(OH)2D3, and LPS In Vivo. Endocrinology. 2019 Dec 1;160(12):2877-2891
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory