About   Help   FAQ
Alg12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Alg12em1(IMPC)J
Name: ALG12 alpha-1,6-mannosyltransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7425011
Gene: Alg12  Location: Chr15:88689448-88703498 bp, - strand  Genetic Position: Chr15, 44.3 cM
Alliance: Alg12em1(IMPC)J page
IMPC: Alg12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAAAAGTACCTATCACCC and CTGAAAGGAAGTCAGAGGCG, which resulted in a 4434 bp deletion beginning at Chromosome 15 position 88,811,214 bp and ending after 88,815,647 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000312413, ENSMUSE00001295588, ENSMUSE00001230922, and ENSMUSE00001279793 (exons 4-7) and 3737 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alg12 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory