Alg12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alg12^em1(IMPC)J
• Name: ALG12 alpha-1,6-mannosyltransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7425011
• Gene: Alg12 Location: Chr15:88689448-88703498 bp, - strand Genetic Position: Chr15, 44.3 cM
• Alliance: Alg12^em1(IMPC)J page
• IMPC: Alg12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTGAAAGGAAGTCAGAGGCG and TTTAAAAGTACCTATCACCC that targeted exon(s) ENSMUSE00000312405.4 ENSMUSE00000312413.4 ENSMUSE00001230922.2 ENSMUSE00001279793.2 ENSMUSE00001295588.2. This resulted in deletion(s) of 4434 bp (location: Chr15:88695417-88699850; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Alg12 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)