Rr207838^em1Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr207838^em1Vmc
• Name: regulatory region 207838; endonuclease-mediated mutation 1, Vincent M Christoffels
• MGI ID: MGI:7423618
• Synonyms: Del(9Rr207838)10Vmc, RE9^-
• Gene: Rr207838 Location: Chr9:119297802-119300999 bp Genetic Position: Chr9, Syntenic
• Alliance: Rr207838^em1Vmc page

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Rr207838^em1Vmc involves 1 genes/genome features (Rr207838) View all
• Mutation details: Cardiac-specific Scn5a enhancer Rr207838, part of a super-enhancer between Exog and Scn5a that also contains enhancers Rr207840 and Rr207839, was targeted with sgRNAs (targeting GGTCTGAGTACCGTAGATGA and GGCACTATTTGAGTTCCACT) using CRISPR/Cas9 technology, resulting in its deletion (~2.3 kb sequence total deleted). (J:281596)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr207838 Mutation: 0 strains or lines available

References

• Original: J:281596 Man JCK, et al., An enhancer cluster controls gene activity and topology of the SCN5A-SCN10A locus in vivo. Nat Commun. 2019 Oct 30;10(1):4943
• All: 1 reference(s)