About   Help   FAQ
Del(9Rr207838-Rr207840)8Vmc
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(9Rr207838-Rr207840)8Vmc
Name: deletion, Chr 9, Vincent M Christoffels 8
MGI ID: MGI:7423616
Synonyms: deltaRE6-9, RE6-9-
Gene: Del(9Rr207838-Rr207840)8Vmc  Location: unknown  Genetic Position: Chr9, Syntenic
Mutation
origin
Strain of Origin:  FVB/NRj
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
  Del(9Rr207838-Rr207840)8Vmc involves 3 genes/genome features (Rr207838, Rr207839, Rr207840) View all
 
Mutation detailsThe super-enhancer between Exog and Scn5a, containing cardiac-specific Scn5a enhancers Rr207838, Rr207839 and Rr207840, was targeted with sgRNAs (targeting GGTCTGAGTACCGTAGATGA and GGGAGCCGAGGGCGCTCCTT) using CRISPR/Cas9 technology, resulting in an ~12.2 kb deletion. (J:281596)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(9Rr207838-Rr207840)8Vmc Mutation:  0 strains or lines available
References
Original:  J:281596 Man JCK, et al., An enhancer cluster controls gene activity and topology of the SCN5A-SCN10A locus in vivo. Nat Commun. 2019 Oct 30;10(1):4943
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory