Cyp2w1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyp2w1^em1(IMPC)J
• Name: cytochrome P450, family 2, subfamily w, polypeptide 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7413932
• Gene: Cyp2w1 Location: Chr5:139338372-139342788 bp, + strand Genetic Position: Chr5, 78.44 cM
• Alliance: Cyp2w1^em1(IMPC)J page
• IMPC: Cyp2w1 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTCCCTAGTACCAATCCAAG and GCCCACTCCAGGTATTCACA that targeted exon(s) ENSMUSE00000189900.4 ENSMUSE00000391270.4 ENSMUSE00000685698.2. This resulted in deletion(s) of 1837 bp (location: Chr5:139339804-139341640; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cyp2w1 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)