Cyp2w1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cyp2w1em1(IMPC)J |
| Name: |
cytochrome P450, family 2, subfamily w, polypeptide 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7413932 |
| Gene: |
Cyp2w1 Location: Chr5:139338372-139342788 bp, + strand Genetic Position: Chr5, 78.44 cM
|
| Alliance: |
Cyp2w1em1(IMPC)J page
|
| IMPC: |
Cyp2w1 gene page |
|
| Strain of Origin: |
Not Applicable
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCCCTAGTACCAATCCAAG and GCCCACTCCAGGTATTCACA, which resulted in a 1837 bp deletion beginning at Chromosome 5 position 139,354,049 bp and ending after 139,355,885 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000189900, ENSMUSE00000391270, and ENSMUSE00000685698 (exons 3,4, and 5) and 1355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 1 amino acid later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|