About   Help   FAQ
Cyp2w1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cyp2w1em1(IMPC)J
Name: cytochrome P450, family 2, subfamily w, polypeptide 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7413932
Gene: Cyp2w1  Location: Chr5:139338372-139342788 bp, + strand  Genetic Position: Chr5, 78.44 cM
Alliance: Cyp2w1em1(IMPC)J page
IMPC: Cyp2w1 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCCCTAGTACCAATCCAAG and GCCCACTCCAGGTATTCACA, which resulted in a 1837 bp deletion beginning at Chromosome 5 position 139,354,049 bp and ending after 139,355,885 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000189900, ENSMUSE00000391270, and ENSMUSE00000685698 (exons 3,4, and 5) and 1355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cyp2w1 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory