Rr338^em1Jeng
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr338^em1Jeng
• Name: regulatory region 338; endonuclease-mediated mutation 1, James Douglas Engel
• MGI ID: MGI:7413214
• Synonyms: Tce1^-
• Gene: Rr338 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr338^em1Jeng page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Modified regulatory region)
• Mutations: Insertion, Intergenic deletion
• Mutation details: The Gata3 T cell and thymic NK cell enhancer (7.1 kb KpnI-SalI T cell element) was targeted with sgRNAs (targeting GACAAATCCCAATATAGCTGAGG and GGAAGCCAGAAGTTGCTATCAGG) and two ssODNs (containing loxP site sequence plus EcoRI restriction site inside the respective sgRNA target sequences in addition to 60 bp left and right homology arms) using CRISPR/Cas9 technology, resulting in its deletion. (J:232438)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr338 Mutation: 0 strains or lines available

References

• Original: J:232438 Ohmura S, et al., Lineage-affiliated transcription factors bind the Gata3 Tce1 enhancer to mediate lineage-specific programs. J Clin Invest. 2016 Mar 1;126(3):865-78
• All: 1 reference(s)