About   Help   FAQ
Rr338em1Jeng
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr338em1Jeng
Name: regulatory region 338; endonuclease-mediated mutation 1, James Douglas Engel
MGI ID: MGI:7413214
Synonyms: Tce1-
Gene: Rr338  Location: Chr2:9588068-9613189 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr338em1Jeng page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Modified regulatory region)
Mutations:    Insertion, Intergenic deletion
 
Mutation detailsThe Gata3 T cell and thymic NK cell enhancer (7.1 kb KpnI-SalI T cell element) was targeted with sgRNAs (targeting GACAAATCCCAATATAGCTGAGG and GGAAGCCAGAAGTTGCTATCAGG) and two ssODNs (containing loxP site sequence plus EcoRI restriction site inside the respective sgRNA target sequences in addition to 60 bp left and right homology arms) using CRISPR/Cas9 technology, resulting in its deletion. (J:232438)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr338 Mutation:  0 strains or lines available
References
Original:  J:232438 Ohmura S, et al., Lineage-affiliated transcription factors bind the Gata3 Tce1 enhancer to mediate lineage-specific programs. J Clin Invest. 2016 Mar 1;126(3):865-78
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory