About   Help   FAQ
Kcnk12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnk12em1(IMPC)J
Name: potassium channel, subfamily K, member 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7411391
Gene: Kcnk12  Location: Chr17:88053229-88105422 bp, - strand  Genetic Position: Chr17, 57.87 cM
Alliance: Kcnk12em1(IMPC)J page
IMPC: Kcnk12 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATCATGAACAACCGGC and GCCTTCCCGCCCACTGTGGC, which resulted in a 870 bp deletion beginning at Chromosome 17 position 87,745,950 bp and ending after 87,746,819 bp (GRCm38/mm10). This mutation deletes 870 bp from ENSMUSE00000336157 (exon 2) and is predicted to cause a 290 amino acid deletion beginning after amino acid residue 137 and termination 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kcnk12 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory