Cacng4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cacng4^em1(IMPC)J
• Name: calcium channel, voltage-dependent, gamma subunit 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7411389
• Gene: Cacng4 Location: Chr11:107623183-107685383 bp, - strand Genetic Position: Chr11, 70.29 cM, cytoband E1
• Alliance: Cacng4^em1(IMPC)J page
• IMPC: Cacng4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACACGGGAGTCGTCCGC and TGATACCGATGATATTACTG, which resulted in a 516 bp deletion beginning at Chromosome 11 position 107,734,797 bp and ending after 107,735,312 bp (GRCm38/mm10). This mutation deletes 516 bp from ENSMUSE00000370668 (exon 4) and is predicted to delete 172 amino acids after amino acid residue 150 and then terminate 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cacng4 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)