About   Help   FAQ
Cacng4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cacng4em1(IMPC)J
Name: calcium channel, voltage-dependent, gamma subunit 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7411389
Gene: Cacng4  Location: Chr11:107623183-107685383 bp, - strand  Genetic Position: Chr11, 70.29 cM, cytoband E1
Alliance: Cacng4em1(IMPC)J page
IMPC: Cacng4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACACGGGAGTCGTCCGC and TGATACCGATGATATTACTG, which resulted in a 516 bp deletion beginning at Chromosome 11 position 107,734,797 bp and ending after 107,735,312 bp (GRCm38/mm10). This mutation deletes 516 bp from ENSMUSE00000370668 (exon 4) and is predicted to delete 172 amino acids after amino acid residue 150 and then terminate 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cacng4 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory