Gabrp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gabrp^em1(IMPC)J
• Name: gamma-aminobutyric acid type A receptor subunit pi; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7411378
• Gene: Gabrp Location: Chr11:33500781-33528959 bp, - strand Genetic Position: Chr11, 19.21 cM
• Alliance: Gabrp^em1(IMPC)J page
• IMPC: Gabrp gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCTCGACTGAAAGACCGTG and GCCGGTGTATCTACATTAGT, which resulted in a 430 bp deletion beginning at Chromosome 11 position 33,517,830 bp and ending after 33,518,259 bp (GRCm38/mm39). This mutation deletes ENSMUSE00000101276 (exon 4) and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 50 amino acids later. There is a single bp A at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gabrp Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)