Gbp5^em1Chez
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gbp5^em1Chez
• Name: guanylate binding protein 5; endonuclease-mediated mutation 1, Zheng Chen
• MGI ID: MGI:7408335
• Gene: Gbp5 Location: Chr3:142202695-142228105 bp, + strand Genetic Position: Chr3, 66.69 cM
• Alliance: Gbp5^em1Chez page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 meidated recombination using guide RNAs (gRNA1:GTGCCTCATTGGGAGCACCG; gRNA2:CTGTACAGTCTCACACCAAG) targeting exons 2 and 3 created a deletion removing part of exon 2 and all of exon 3. Western blot and qPCR analyses confirmed the absnece of expression in homozygous mice. (J:329548)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gbp5 Mutation: 39 strains or lines available

References

• Original: J:329548 Ding K, et al., GBP5 promotes liver injury and inflammation by inducing hepatocyte apoptosis. FASEB J. 2022 Jan;36(1):e22119
• All: 1 reference(s)