About   Help   FAQ
Il13ra1em1Liah
Endonuclease-mediated Allele Detail
Summary
Symbol: Il13ra1em1Liah
Name: interleukin 13 receptor, alpha 1; endonuclease-mediated mutation 1, Hong-Erh Liang
MGI ID: MGI:7408305
Gene: Il13ra1  Location: ChrX:35375763-35434912 bp, + strand  Genetic Position: ChrX, 20.49 cM
Alliance: Il13ra1em1Liah page
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsZygotes carrying Arg1tm1.1Lky, Il5tm1.1(icre)Lky and Il13tm2.1Lky were targeted for CRISPR-cas9 mediated recombination using guide RNAs (ACGCTCAAATTCGTCACAGGTGG and TCCTGAGCCACAGCATGTACTGG) targeting exon 2 to create a null allele. (J:329938)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Il13ra1 Mutation:  17 strains or lines available
References
Original:  J:329938 Ricardo-Gonzalez RR, et al., Innate type 2 immunity controls hair follicle commensalism by Demodex mites. Immunity. 2022 Oct 11;55(10):1891-1908.e12
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory