About   Help   FAQ
Rr328em4Hysh
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr328em4Hysh
Name: regulatory region 328; endonuclease-mediated mutation 4, Ha Youn Shin
MGI ID: MGI:7408240
Synonyms: deltaE1D
Gene: Rr328  Location: Chr11:6589199-6589304 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr328em4Hysh page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsCRISPR-targeting enhancer E1 (part of Wap super enhancer) with sgRNAs (targeting CTTCCTTGCAAGAGAAATCA and GTATGGGCCCTTCTGGGAAG) deleted 97 bp encompassing the STAT5-, NFIB- and ELF5-binding sites. (J:330902)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr328 Mutation:  0 strains or lines available
References
Original:  J:330902 Kim U, et al., Mammary-Enriched Transcription Factors Synergize to Activate the Wap Super-Enhancer for Mammary Gland Development. Int J Mol Sci. 2022 Oct 2;23(19)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory