Rr328^em2Hysh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr328^em2Hysh
• Name: regulatory region 328; endonuclease-mediated mutation 2, Ha Youn Shin
• MGI ID: MGI:7408238
• Synonyms: deltaE1B
• Gene: Rr328 Location: Chr11:6589199-6589304 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr328^em2Hysh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: CRISPR-targeting enhancer E1 (part of Wap super enhancer) with sgRNAs (targeting CTTCCTTGCAAGAGAAATCA and GTATGGGCCCTTCTGGGAAG) deleted 48 bp across two regions (5+43 bp) encompassing the STAT5- and ELF5-binding sites. (J:330902)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr328 Mutation: 0 strains or lines available

References

• Original: J:330902 Kim U, et al., Mammary-Enriched Transcription Factors Synergize to Activate the Wap Super-Enhancer for Mammary Gland Development. Int J Mol Sci. 2022 Oct 2;23(19)
• All: 1 reference(s)