Rr328^em2Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr328^em2Mam
• Name: regulatory region 328; endonuclease-mediated mutation 2, Lothar Hennighausen
• MGI ID: MGI:7408214
• Synonyms: GAS^deltaE1b
• Gene: Rr328 Location: Chr11:6589199-6589304 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr328^em2Mam page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting an sgRNA (targeting TGGAAGGCCACTTCCCAGAA) deleted 28 bp (CTTCCCAGAAGGGCCCATACTGTGCCAA), which includes the interferonactivated sequence (GAS) motif and an NFIB-binding site, within the E1 enhancer (part of Wap super enhancer) upstream of Wap. (J:277922)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr328 Mutation: 0 strains or lines available

References

• Original: J:277922 Shin HY, et al., Hierarchy within the mammary STAT5-driven Wap super-enhancer. Nat Genet. 2016 Aug;48(8):904-911
• All: 2 reference(s)