About   Help   FAQ
Adat2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adat2em1(IMPC)J
Name: adenosine deaminase, tRNA-specific 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7408173
Gene: Adat2  Location: Chr10:13428651-13439120 bp, + strand  Genetic Position: Chr10, 4.94 cM, cytoband A2
Alliance: Adat2em1(IMPC)J page
IMPC: Adat2 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATCATAAACTCACCAACA and ATGCAGCAAGTACAAGAGCC, which resulted in a 476 bp deletion beginning at Chromosome 10 position 13,435,665 bp and ending after 13,436,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000098195 (exon 3) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Adat2 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory