About   Help   FAQ
In(11Rr325)1Smun
Endonuclease-mediated Allele Detail
Summary
Symbol: In(11Rr325)1Smun
Name: inversion, Chr 11, Stefan Mundlos 1
MGI ID: MGI:7407294
Synonyms: InvC
Gene: In(11Rr325)1Smun  Location: unknown  Genetic Position: Chr11, Syntenic
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutations:    Insertion, Inversion
  In(11Rr325)1Smun involves 1 genes/genome features (Rr325) View all
 
Mutation detailsThe centromeric part of the Sox9 topologically associated domain (TAD), including border (insulator) region Rr325 that separates it from the Kcnj TAD, was targeted with sgRNAs (targeting ATCATTTTAGGTAACGACCC and GAAGCAAATACGTGAGTCTAC) using CRISPR/Cas9 technology, resulting in its inversion. (J:282642)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 10 assay results
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any In(11Rr325)1Smun Mutation:  0 strains or lines available
References
Original:  J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory