About   Help   FAQ
Igs47em1(Rr325)Smun
Endonuclease-mediated Allele Detail
Summary
Symbol: Igs47em1(Rr325)Smun
Name: intergenic sequence 47; endonuclease-mediated mutation 1, Stefan Mundlos
MGI ID: MGI:7407293
Synonyms: Bor-Knockin
Gene: Igs47  Location: Chr11:112544203-112544222 bp  Genetic Position: Chr11, Syntenic
Alliance: Igs47em1(Rr325)Smun page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:282642
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Insertion
 
Mutation detailsA 6.3 kb sequence, containing the border (insulator) region between the Kcnj and Sox9 topologically associated domains (TADs), was targeted for insertion in Rr325em1Smun Rr325 deletion allele ES cells about 125 kb upstream of Sox9 with an sgRNA (targeting GGAGGGACACTGATATTTCT) using CRISPR/Cas9 technology. (J:282642)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Igs47 Mutation:  0 strains or lines available
References
Original:  J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory