About   Help   FAQ
Dp(11)2Smun
Endonuclease-mediated Allele Detail
Summary
Symbol: Dp(11)2Smun
Name: duplication, Chr 11, Stefan Mundlos 2
MGI ID: MGI:7398591
Synonyms: Dup-LdeltaBor
Gene: Dp(11)2Smun  Location: unknown  Genetic Position: Chr11, Syntenic
Mutation
origin
Strain of Origin:  129P2/OlaHsd
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Modified regulatory region, Reporter)
Mutations:    Duplication, Insertion
 
Mutation detailsThis duplication allele was created through cre-mediated interchromosomal recombination between loxP sites on two alleles: allele Igs44tm1(sb-SBlac)Smun containing an SBlac cassette at chr11:110989101-110989102 (GRCm39), and allele Igs45tm1(sb-SBlac)Smun containing an SBlac cassette at chr11:112544204-112544205. The duplicated sequence contains boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively. It duplicates most of the Sox9 TAD and less than half of the Kcnj TAD but leaves the genes intact. The recombination between the loxP sites in the two SBlac cassettes leaves one intact cassette at the duplication junction. Subsequent to the duplication, the allele was subjected to targeting both copies of Rr325 with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in two 18.342 kb deletions (chr11:111413371-111431712 (GRCm39) for the original insulator). (J:235642)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dp(11)2Smun Mutation:  0 strains or lines available
References
Original:  J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory