About   Help   FAQ
Rr325em1Smun
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr325em1Smun
Name: regulatory region 325; endonuclease-mediated mutation 1, Stefan Mundlos
MGI ID: MGI:7398533
Synonyms: deltaBor
Gene: Rr325  Location: Chr11:111413371-111431712 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr325em1Smun page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:282642
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsBoundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively, was targeted with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in an 18.342 kb deletion (chr11:111413371-111431712 (GRCm39)). (J:235642)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr325 Mutation:  0 strains or lines available
References
Original:  J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory