Rr325^em1Smun
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr325^em1Smun
• Name: regulatory region 325; endonuclease-mediated mutation 1, Stefan Mundlos
• MGI ID: MGI:7398533
• Synonyms: deltaBor
• Gene: Rr325 Location: Chr11:111413371-111431712 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr325^em1Smun page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:282642
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively, was targeted with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in an 18.342 kb deletion (chr11:111413371-111431712 (GRCm39)). (J:235642)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr325 Mutation: 0 strains or lines available

References

• Original: J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269
• All: 2 reference(s)