Igdmr^em1Yste
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igdmr^em1Yste
• Name: intergenic germline-derived differentially methylated region; endonuclease-mediated mutation 1, Yonatan Stelze
• MGI ID: MGI:7398487
• Synonyms: IG-CGI^f
• Gene: Igdmr Location: Chr12:109492765-109496915 bp Genetic Position: Chr12, Syntenic
• Alliance: Igdmr^em1Yste page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 endonuclease-mediated homology-directed repair (HDR) genome editing including two guide RNAs (CACCgTACACGCTATATTTGTGCTA; AAACTAGCACAAATATAGCGTGTAc and CACCgTACAGACTGTAGTTTAGCTT; AAACAAGCTAAACTACAGTCTGTA) is used to insert loxP sites flanking the CpG island (CGI) located at the 5prime portion of the region. (J:331751)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Igdmr Mutation: 2 strains or lines available

References

• Original: J:331751 Weinberg-Shukron A, et al., Balanced gene dosage control rather than parental origin underpins genomic imprinting. Nat Commun. 2022 Jul 29;13(1):4391
• All: 1 reference(s)