Ankdd1bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ankdd1bem1(IMPC)J |
| Name: |
ankyrin repeat and death domain containing 1B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7388263 |
| Gene: |
Ankdd1b Location: Chr13:96552642-96607766 bp, - strand Genetic Position: Chr13, 50.56 cM
|
| Alliance: |
Ankdd1bem1(IMPC)J page
|
| IMPC: |
Ankdd1b gene page |
|
| Strain of Origin: |
Not Applicable
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACACTCCTGAGAATGTT and CTTTTGTCATCCAAGTTGGA, which resulted in a 524 bp deletion beginning at Chromosome 13 position 96,420,527 bp and ending after 96,421,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289218 (exon 13) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 423 and early truncation 21 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|