Mitd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mitd1em1(IMPC)J |
| Name: |
MIT, microtubule interacting and transport, domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7388256 |
| Gene: |
Mitd1 Location: Chr1:37913882-37929492 bp, - strand Genetic Position: Chr1, 16.13 cM, cytoband B
|
| Alliance: |
Mitd1em1(IMPC)J page
|
| IMPC: |
Mitd1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACAGGTCCTATGTCATGT and AAGCTACAGTAACGTAACCA, which resulted in a 2192 bp deletion beginning at Chromosome 1 position 37,880,718 bp and ending after 37,882,909 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155673, ENSMUSE00000155677, and ENSMUSE00001272681 (exons 3,4,and 5) and 1852 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 6 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|