Mitd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mitd1^em1(IMPC)J
• Name: MIT, microtubule interacting and transport, domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7388256
• Gene: Mitd1 Location: Chr1:37913882-37929492 bp, - strand Genetic Position: Chr1, 16.13 cM, cytoband B
• Alliance: Mitd1^em1(IMPC)J page
• IMPC: Mitd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACAGGTCCTATGTCATGT and AAGCTACAGTAACGTAACCA, which resulted in a 2192 bp deletion beginning at Chromosome 1 position 37,880,718 bp and ending after 37,882,909 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155673, ENSMUSE00000155677, and ENSMUSE00001272681 (exons 3,4,and 5) and 1852 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mitd1 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)