Ly6g5b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ly6g5b^em1(IMPC)J
• Name: lymphocyte antigen 6 family member G5B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7386928
• Gene: Ly6g5b Location: Chr17:35332924-35334404 bp, - strand Genetic Position: Chr17, 18.59 cM
• Alliance: Ly6g5b^em1(IMPC)J page
• IMPC: Ly6g5b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGACTTCTGGTCCTTCCCT and CTACTGTTCGCTTCCACGTA, which resulted in a 365 bp deletion beginning at Chromosome 17 position 35,114,431 bp and ending after 35,114,795 bp (GRCm38/mm10). This mutation deletes 365 bp from ENSMUSE00000932901 (exon 3) and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ly6g5b Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)