Kcnb1^em1Sesf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnb1^em1Sesf
• Name: potassium voltage gated channel, Shab-related subfamily, member 1; endonuclease-mediated mutation 1, Federico Sesti
• MGI ID: MGI:7385066
• Synonyms: Kcnb1^R312H
• Gene: Kcnb1 Location: Chr2:166937889-167032075 bp, - strand Genetic Position: Chr2, 87.22 cM
• Alliance: Kcnb1^em1Sesf page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing is used to select Guide RNA [CATCCTGCGCATCCTGAAGT] and donor DNA to insert an R312H point mutation (arginine to histidine, NM_004975.2:c.935G to A). THe R312H variant has been identified in children with developmental and epileptic ecephalopathies (DEEs). (J:331047)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnb1 Mutation: 45 strains or lines available

References

• Original: J:331047 Bortolami A, et al., Integrin-KCNB1 potassium channel complexes regulate neocortical neuronal development and are implicated in epilepsy. Cell Death Differ. 2022 Oct 7
• All: 2 reference(s)