About   Help   FAQ
Rr323em1Juhi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr323em1Juhi
Name: regulatory region 323; endonuclease-mediated mutation 1, Junji Hirota
MGI ID: MGI:7384821
Synonyms: deltaJ
Gene: Rr323  Location: Chr7:102159128-102159557 bp  Genetic Position: Chr7, Syntenic
Alliance: Rr323em1Juhi page
Mutation
origin
Strain of Origin:  (C57BL/6 x C3H)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe class I olfactory receptor olfactory sensory neuron (OSN) enhancer was targeted with sgRNAs (targeting CACCGTCTCATTGCCACCCGGATGA, AAACTCATCCGGGTGGCAATGAGAC, CACCGCCCCTCCACCGTACTTGCA and AAACTGCAAGTACGGTGGAGGGGC) using CRISPR/Cas9 technology, resulting in a 1982 bp deletion. (J:254398)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr323 Mutation:  0 strains or lines available
References
Original:  J:254398 Iwata T, et al., A long-range cis-regulatory element for class I odorant receptor genes. Nat Commun. 2017 Oct 12;8(1):885
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory