Runx3^em1Itan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Runx3^em1Itan
• Name: runt related transcription factor 3; endonuclease-mediated mutation 1, Ichiro Taniuchi
• MGI ID: MGI:7384495
• Synonyms: Runx3^deltaY
• Gene: Runx3 Location: Chr4:134847963-134905301 bp, + strand Genetic Position: Chr4, 67.19 cM
• Alliance: Runx3^em1Itan page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: The last codon (tyrosine TAC) was targeted with an sgRNA (targeting TGTGGCGGCCCTACTAAGCA) using CRISPR/Cas9 technology, resulting in its deletion. (J:287321)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Runx3 Mutation: 28 strains or lines available

References

• Original: J:287321 Seo W, et al., Runx-mediated regulation of CCL5 via antagonizing two enhancers influences immune cell function and anti-tumor immunity. Nat Commun. 2020 Mar 26;11(1):1562
• All: 1 reference(s)