About   Help   FAQ
Rr321em1Itan
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr321em1Itan
Name: regulatory region 321; endonuclease-mediated mutation 1, Ichiro Taniuchi
MGI ID: MGI:7384492
Synonyms: Ccl5deltaPE
Gene: Rr321  Location: Chr11:83425936-83426120 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr321em1Itan page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Ccl5 proximal enhancer was targeted with sgRNAs (targeting TGCAGAGGGCCCTACTGACA and ACATGCGGTGTGTTTGTGAT) using CRISPR/Cas9 technology, resulting in a 185 bp deletion. (J:287321)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr321 Mutation:  0 strains or lines available
References
Original:  J:287321 Seo W, et al., Runx-mediated regulation of CCL5 via antagonizing two enhancers influences immune cell function and anti-tumor immunity. Nat Commun. 2020 Mar 26;11(1):1562
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory