Kcnma1^em2Alme
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnma1^em2Alme
• Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1; endonuclease-mediated mutation 2, Andrea Meredith
• MGI ID: MGI:7384342
• Synonyms: Kcnma1^D434G
• Gene: Kcnma1 Location: Chr14:23342356-24055173 bp, - strand Genetic Position: Chr14, 12.92 cM
• Alliance: Kcnma1^em2Alme page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting GGACCGGGATGATGTCAACG) and ssODN template (CTCTGGAGAGTGTCTCTAACTTCCTGAAGGACTTTCTGCACAAGGACCGtGgTGATGTCAACGTtGAGATTGTCTTTCTTCACAAGTAAGAGCCCCCTGCTGCCACCAGACCCTGCCACC) to change aspartic acid codon 434 (GAT) to serine (GGT) (ENSMUSP00000153247:p.D434G). The mutation is associated with paroxysmal dyskinesia in KCNMA1-linked channelopathy patients. The affected aspartic acid residue is located within the alphaA and alphaB of the AC domain, which is within the regulator of conductance of potassium 1 (RCK1) domain. (J:330716)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnma1 Mutation: 105 strains or lines available

References

• Original: J:330716 Park SM, et al., BK channel properties correlate with neurobehavioral severity in three KCNMA1-linked channelopathy mouse models. Elife. 2022 Jul 12;11:e77953
• All: 1 reference(s)