About   Help   FAQ
Kcnma1em2Alme
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnma1em2Alme
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1; endonuclease-mediated mutation 2, Andrea Meredith
MGI ID: MGI:7384342
Synonyms: Kcnma1D434G
Gene: Kcnma1  Location: Chr14:23342356-24055173 bp, - strand  Genetic Position: Chr14, 12.92 cM
Alliance: Kcnma1em2Alme page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsCRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting GGACCGGGATGATGTCAACG) and ssODN template (CTCTGGAGAGTGTCTCTAACTTCCTGAAGGACTTTCTGCACAAGGACCGtGgTGATGTCAACGTtGAGATTGTCTTTCTTCACAAGTAAGAGCCCCCTGCTGCCACCAGACCCTGCCACC) to change aspartic acid codon 434 (GAT) to serine (GGT) (ENSMUSP00000153247:p.D434G). The mutation is associated with paroxysmal dyskinesia in KCNMA1-linked channelopathy patients. The affected aspartic acid residue is located within the alphaA and alphaB of the AC domain, which is within the regulator of conductance of potassium 1 (RCK1) domain. (J:330716)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnma1 Mutation:  105 strains or lines available
References
Original:  J:330716 Park SM, et al., BK channel properties correlate with neurobehavioral severity in three KCNMA1-linked channelopathy mouse models. Elife. 2022 Jul 12;11:e77953
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory