Kcnma1em1Alme
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcnma1em1Alme |
| Name: |
potassium large conductance calcium-activated channel, subfamily M, alpha member 1; endonuclease-mediated mutation 1, Andrea Meredith |
| MGI ID: |
MGI:7384340 |
| Synonyms: |
Kcnma1N999S |
| Gene: |
Kcnma1 Location: Chr14:23342356-24055173 bp, - strand Genetic Position: Chr14, 12.92 cM
|
| Alliance: |
Kcnma1em1Alme page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting CTGTATGAAGTTACTGTTAT) and ssODN template (AGATACTAAGAAAAGTTGTAATTTGGACATCAATTGTGATTTTCGGTGTTGGCTTAAGAATGCTTCTCTTCTACCTTCTTTCTCCAGACATAtTTCAgTGACAATATtCTCACCCTAATACGGACCCTGGTGACAGGAGGAGCCACACCA) to change asparagine codon 995 (AAT) in exon 25 to serine (AGT) (ENSMUSP00000140033:p.N995S). This mutation is the equivalent of the human p.N999S mutation which, in heterozygous form, is the most common de novo KCNMA1 variant found in KCNMA1-linked channelopathy patients (17%), half of which develop seizures, paroxysmal non-kinesigenic dyskinesia (PKND3), or both.
(J:330716)
|
|
|
|
|
| Original: |
J:330716 Park SM, et al., BK channel properties correlate with neurobehavioral severity in three KCNMA1-linked channelopathy mouse models. Elife. 2022 Jul 12;11:e77953 |
| All: |
1 reference(s) |
|