About   Help   FAQ
Kcnma1em1Alme
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnma1em1Alme
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1; endonuclease-mediated mutation 1, Andrea Meredith
MGI ID: MGI:7384340
Synonyms: Kcnma1N999S
Gene: Kcnma1  Location: Chr14:23342356-24055173 bp, - strand  Genetic Position: Chr14, 12.92 cM
Alliance: Kcnma1em1Alme page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsCRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting CTGTATGAAGTTACTGTTAT) and ssODN template (AGATACTAAGAAAAGTTGTAATTTGGACATCAATTGTGATTTTCGGTGTTGGCTTAAGAATGCTTCTCTTCTACCTTCTTTCTCCAGACATAtTTCAgTGACAATATtCTCACCCTAATACGGACCCTGGTGACAGGAGGAGCCACACCA) to change asparagine codon 995 (AAT) in exon 25 to serine (AGT) (ENSMUSP00000140033:p.N995S). This mutation is the equivalent of the human p.N999S mutation which, in heterozygous form, is the most common de novo KCNMA1 variant found in KCNMA1-linked channelopathy patients (17%), half of which develop seizures, paroxysmal non-kinesigenic dyskinesia (PKND3), or both. (J:330716)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnma1 Mutation:  106 strains or lines available
References
Original:  J:330716 Park SM, et al., BK channel properties correlate with neurobehavioral severity in three KCNMA1-linked channelopathy mouse models. Elife. 2022 Jul 12;11:e77953
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory