Gt(ROSA)26Sorem1(LoxCode)Naik
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sorem1(LoxCode)Naik |
| Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Shalin Naik |
| MGI ID: |
MGI:7380576 |
| Synonyms: |
Gt(ROSA)26Sorem1Naik, LoxCode |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sorem1(LoxCode)Naik page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Lineage barcode) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: Plasmids encoding a guide RNA (CTCCAGTCTTTCTAGAAGAT) are designed to insert the LoxCode cassette into the endogenous Gt(ROSA)26Sor locus. The LoxCode cassette is composed of 14 loxP sites in alternating orientation flanking 13 small (8-14nts) code elements. Upon Cre exposure, random recombination between the loxP sites lead to inversions and excisions, resulting in DNA sequence reshuffling with a theoretical DNA diversity of over 30 billion barcodes.
(J:332372)
|
|
|
|
|
| Original: |
J:332372 Biben C, et al., In vivo clonal tracking reveals evidence of haemangioblast and haematomesoblast contribution to yolk sac haematopoiesis. Nat Commun. 2023 Jan 3;14(1):41 |
| All: |
3 reference(s) |
|