About   Help   FAQ
Gt(ROSA)26Sorem1(LoxCode)Naik
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(LoxCode)Naik
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Shalin Naik
MGI ID: MGI:7380576
Synonyms: Gt(ROSA)26Sorem1Naik, LoxCode
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(LoxCode)Naik page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Lineage barcode)
Mutation:    Insertion
 
Mutation detailsPlasmids encoding a guide RNA (CTCCAGTCTTTCTAGAAGAT) are designed to insert the LoxCode cassette into the endogenous Gt(ROSA)26Sor locus. The LoxCode cassette is composed of 14 loxP sites in alternating orientation flanking 13 small (8-14nts) code elements. Upon Cre exposure, random recombination between the loxP sites lead to inversions and excisions, resulting in DNA sequence reshuffling with a theoretical DNA diversity of over 30 billion barcodes. (J:332372)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1089 strains or lines available
References
Original:  J:332372 Biben C, et al., In vivo clonal tracking reveals evidence of haemangioblast and haematomesoblast contribution to yolk sac haematopoiesis. Nat Commun. 2023 Jan 3;14(1):41
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory