About   Help   FAQ
Serpine3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpine3em1(IMPC)J
Name: serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7378851
Gene: Serpine3  Location: Chr14:62901116-62929692 bp, + strand  Genetic Position: Chr14, 33.23 cM
Alliance: Serpine3em1(IMPC)J page
IMPC: Serpine3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGATGGCTCCCTAAGACA and TAGAATAGACTCAAACTCCA, which resulted in a 593 bp deletion beginning at Chromosome 14 position 62,674,033 bp and ending after 62,674,625 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000883429 (exon 5) and 394 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 231 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Serpine3 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory