Mt4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mt4^em1(IMPC)J
• Name: metallothionein 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7378844
• Gene: Mt4 Location: Chr8:94863832-94865659 bp, + strand Genetic Position: Chr8, 46.26 cM
• Alliance: Mt4^em1(IMPC)J page
• IMPC: Mt4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCCTTAACACTATGGCA and ACCGGAACCCCACTCACACG, which resulted in a 2150 bp deletion beginning at Chromosome 8 position 94,136,987 bp and ending after 94,139,136 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635105, ENSMUSE00000212736, and ENSMUSE00000635102 (exons 1-3) and 1752 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mt4 Mutation: 5 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)