About   Help   FAQ
Ap5s1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap5s1em1(IMPC)J
Name: adaptor-related protein 5 complex, sigma 1 subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7378565
Gene: Ap5s1  Location: Chr2:131052280-131055434 bp, + strand  Genetic Position: Chr2, 63.29 cM, cytoband F3
Alliance: Ap5s1em1(IMPC)J page
IMPC: Ap5s1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGCACTAGATTATTCAG and AGCAGACTCCCACTCACAAG, which resulted in a 2400 bp deletion beginning at Chromosome 2 position 131,211,143 bp and ending after 131,213,542 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558540, ENSMUSE00001373302, ENSMUSE00000558538 (exons 2, 3, and 4) and 1210 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ap5s1 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory