Ap5s1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap5s1^em1(IMPC)J
• Name: adaptor-related protein 5 complex, sigma 1 subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7378565
• Gene: Ap5s1 Location: Chr2:131052280-131055434 bp, + strand Genetic Position: Chr2, 63.29 cM, cytoband F3
• Alliance: Ap5s1^em1(IMPC)J page
• IMPC: Ap5s1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGCACTAGATTATTCAG and AGCAGACTCCCACTCACAAG, which resulted in a 2400 bp deletion beginning at Chromosome 2 position 131,211,143 bp and ending after 131,213,542 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558540, ENSMUSE00001373302, ENSMUSE00000558538 (exons 2, 3, and 4) and 1210 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ap5s1 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)