About   Help   FAQ
Gpr151em1Sald
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr151em1Sald
Name: G protein-coupled receptor 151; endonuclease-mediated mutation 1, Danish Saleheen
MGI ID: MGI:7378264
Gene: Gpr151  Location: Chr18:42710946-42712717 bp, - strand  Genetic Position: Chr18, 22.71 cM
Alliance: Gpr151em1Sald page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology using two sgRNAs targeting sites just upstream of the translation start codon in exon 1 (ATCAAGCTCCTCCCTGCAGA) and within the 3 untranslated region (TCATCAATATTGCTAAGCAG) generated a 1343 bp deletion. (J:330349)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gpr151 Mutation:  17 strains or lines available
References
Original:  J:330349 Gurtan A, et al., Analyzing human knockouts to validate GPR151 as a therapeutic target for reduction of body mass index. PLoS Genet. 2022 Apr;18(4):e1010093
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory