Gpr151^em1Sald
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr151^em1Sald
• Name: G protein-coupled receptor 151; endonuclease-mediated mutation 1, Danish Saleheen
• MGI ID: MGI:7378264
• Gene: Gpr151 Location: Chr18:42710946-42712717 bp, - strand Genetic Position: Chr18, 22.71 cM
• Alliance: Gpr151^em1Sald page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using two sgRNAs targeting sites just upstream of the translation start codon in exon 1 (ATCAAGCTCCTCCCTGCAGA) and within the 3 untranslated region (TCATCAATATTGCTAAGCAG) generated a 1343 bp deletion. (J:330349)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gpr151 Mutation: 19 strains or lines available

References

• Original: J:330349 Gurtan A, et al., Analyzing human knockouts to validate GPR151 as a therapeutic target for reduction of body mass index. PLoS Genet. 2022 Apr;18(4):e1010093
• All: 1 reference(s)