Slc4a8^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc4a8^em1(IMPC)Mbp
• Name: solute carrier family 4 (anion exchanger), member 8; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7377683
• Gene: Slc4a8 Location: Chr15:100659628-100721849 bp, + strand Genetic Position: Chr15, 56.39 cM, cytoband F3
• Alliance: Slc4a8^em1(IMPC)Mbp page
• IMPC: Slc4a8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Not Specified
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GCGGTGTTTGCCGTGCCAGC and TGTATCCGTATGACGGTGTC that targeted exon(s) ENSMUSE00000550065.2. This resulted in deletion(s) of 746 bp (location: Chr15:100682235-100682980; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc4a8 Mutation: 55 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 4 reference(s)