Lancl1^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lancl1^em1(IMPC)Mbp
• Name: LanC (bacterial lantibiotic synthetase component C)-like 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7377678
• Gene: Lancl1 Location: Chr1:67039676-67078031 bp, - strand Genetic Position: Chr1, 33.75 cM, cytoband C2-C5
• Alliance: Lancl1^em1(IMPC)Mbp page
• IMPC: Lancl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Not Specified
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CCAAAGTAGTGCATTGGGAA and GGCGATTCCTTAACTATAAG that targeted exon(s) ENSMUSE00001262065.2. This resulted in deletion(s) of 810 bp (location: Chr1:67059870-67060679; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lancl1 Mutation: 23 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 3 reference(s)