Tmem238^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem238^{em1(IMPC)Kmpc}
• Name: transmembrane protein 238; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7377635
• Gene: Tmem238 Location: Chr7:4787784-4792559 bp, - strand Genetic Position: Chr7, 2.77 cM, cytoband A1
• Alliance: Tmem238^{em1(IMPC)Kmpc} page
• IMPC: Tmem238 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences CAGGAGCTGGAGCGTGACTA and CTGCAGCTGCGCGAACACGC that targeted exon(s) ENSMUSE00000892307.2. This resulted in deletion(s) of 103 bp (location: Chr7:4792275-4792377; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem238 Mutation: 6 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)