Tmem120a^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem120a^{em1(IMPC)Kmpc}
• Name: transmembrane protein 120A; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7377615
• Gene: Tmem120a Location: Chr5:135764344-135773026 bp, - strand Genetic Position: Chr5, 75.38 cM
• Alliance: Tmem120a^{em1(IMPC)Kmpc} page
• IMPC: Tmem120a gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using protein and 4 guides with spacer sequences CACTGTAGTAGGAACTTCAA, GAGATGACTTAGGCTACACT, and GTTGAGGACATGTACCACGG that targeted exon(s) ENSMUSE00001239566.2 ENSMUSE00001241559.2 ENSMUSE00001522040.1 ENSMUSE00001875818.1 ENSMUSE00001875820.1 ENSMUSE00001875821.1 ENSMUSE00001875847.1. This resulted in deletion(s) of 738 bp (location: Chr5:135770693-135771430; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem120a Mutation: 19 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)