Nuf2^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nuf2^{em1(IMPC)Kmpc}
• Name: NUF2, NDC80 kinetochore complex component; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7377592
• Gene: Nuf2 Location: Chr1:169325503-169359033 bp, - strand Genetic Position: Chr1, 76.84 cM
• Alliance: Nuf2^{em1(IMPC)Kmpc} page
• IMPC: Nuf2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and a guide with spacer sequence GAAGAAAATCGCTCTTCGAG that targeted exon(s) ENSMUSE00000161839.2. This resulted in deletion(s) of 17 bp (location: Chr1:169342507-169342523; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nuf2 Mutation: 31 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)