About   Help   FAQ
Rr307em1Cdon
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr307em1Cdon
Name: regulatory region 307; endonuclease-mediated mutation 1, Chen Dong
MGI ID: MGI:7367591
Synonyms: CNS9-deficient
Gene: Rr307  Location: Chr3:94290698-94292800 bp  Genetic Position: Chr3, Syntenic
Alliance: Rr307em1Cdon page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Rorc cis-regulatory element, located in intron 1 of splice variant ENSMUST00000197040 or intron 2 of ENSMUST00000029795, was targeted with sgRNAs (targeting AGGGTCTCAAACTATACGCC, CCGTGGCTTGGCCTAATCTC and CAACTCTCGACTATCCACTC) using CRISPR/Cas9 technology, resulting in a 2,162 bp deletion. (J:305606)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr307 Mutation:  0 strains or lines available
References
Original:  J:305606 Chang D, et al., The Conserved Non-coding Sequences CNS6 and CNS9 Control Cytokine-Induced Rorc Transcription during T Helper 17 Cell Differentiation. Immunity. 2020 Sep 15;53(3):614-626.e4
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory