Rr305em1Drf
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr305em1Drf |
| Name: |
regulatory region 305; endonuclease-mediated mutation 1, David R FitzPatrick |
| MGI ID: |
MGI:7367487 |
| Synonyms: |
Fmr1CRE |
| Gene: |
Rr305 Location: ChrX:67619367-67619546 bp Genetic Position: ChrX, Syntenic
|
| Alliance: |
Rr305em1Drf page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
A C>T mutation was engineered in the highly conserved Fmr1 cis-regulatory element (CRE) using an sgRNA (targeting ACCTTGTGTCTATGACTATTTGG) and a ssODN template (TAAGATGGATTCATATTAGGGCTCAAATGCATTGATAGCATTCTACATATTTTTATCCATTTTTATTCCAAGCTACTTTTATCCAAATAGTTATAGACACAAGGTTATTGCAAATTGTATTTGTCTGCTGCCATAGT GCTTTCTATTTTAGAGGAGTAGAAGTAACTATCTCCTTAACAA) with CRISPR/Cas9 technology. The mutation mimics one found in some families with individuals presenting with X-linked intellectual disability (XLID).
(J:308813)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr305 Mutation: |
0 strains or lines available
|
|
| Original: |
J:308813 Bengani H, et al., Identification and functional modelling of plausibly causative cis-regulatory variants in a highly-selected cohort with X-linked intellectual disability. PLoS One. 2021;16(8):e0256181 |
| All: |
1 reference(s) |
|