About   Help   FAQ
Rr305em1Drf
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr305em1Drf
Name: regulatory region 305; endonuclease-mediated mutation 1, David R FitzPatrick
MGI ID: MGI:7367487
Synonyms: Fmr1CRE
Gene: Rr305  Location: ChrX:67619367-67619546 bp  Genetic Position: ChrX, Syntenic
Alliance: Rr305em1Drf page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Single point mutation
 
Mutation detailsA C>T mutation was engineered in the highly conserved Fmr1 cis-regulatory element (CRE) using an sgRNA (targeting ACCTTGTGTCTATGACTATTTGG) and a ssODN template (TAAGATGGATTCATATTAGGGCTCAAATGCATTGATAGCATTCTACATATTTTTATCCATTTTTATTCCAAGCTACTTTTATCCAAATAGTTATAGACACAAGGTTATTGCAAATTGTATTTGTCTGCTGCCATAGT GCTTTCTATTTTAGAGGAGTAGAAGTAACTATCTCCTTAACAA) with CRISPR/Cas9 technology. The mutation mimics one found in some families with individuals presenting with X-linked intellectual disability (XLID). (J:308813)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr305 Mutation:  0 strains or lines available
References
Original:  J:308813 Bengani H, et al., Identification and functional modelling of plausibly causative cis-regulatory variants in a highly-selected cohort with X-linked intellectual disability. PLoS One. 2021;16(8):e0256181
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory